View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_19 (Length: 285)
Name: NF10437_1D_low_19
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_19 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 931982 - 932266
Alignment:
| Q |
1 |
ggattgagttgaaactgaggtcacttcactctcaagaacgtaaatatgaaaaagagcttgcggcactcaattatacaaagcagcttgatttttcacactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
931982 |
ggattgagttgaaactgaggtcacttcactctcaagaacgtaaatatgaaaaagagcttgcggcactcaattatacaaagcagcttgatttttcacactt |
932081 |
T |
 |
| Q |
101 |
aacattagatggttccggcatcaaatcggtacctatttctggtcggatgcataggaataaaattatgaagaggnnnnnnngagtaagagttgaagagaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
932082 |
aacattagatggttccggcatcaaatcggtacctatttctggtcggatgcataggaataaaattatgaagaggaaaaaaagagtaagagttgaagagaaa |
932181 |
T |
 |
| Q |
201 |
tgtgatttagcatcacacatgtctaaccatactttattctcctactatggtatgccatttccttatatatttttgtttttaaaat |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
932182 |
tgtgatttagcatcacacatgtctaaccatactttattctcctactatggtatgccatttccttatatatttttgtttttaaaat |
932266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University