View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_22 (Length: 269)
Name: NF10437_1D_low_22
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 57 - 248
Target Start/End: Complemental strand, 31417709 - 31417517
Alignment:
| Q |
57 |
ggttggttggtttaaacaagaggagaaa-ggggagcattttcagatgaggtagcgcatgccagtcttacaacacctctgtttgatgactatggaggattc |
155 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31417709 |
ggttggttggtttaaacaagaggagaaaaggggagcattttcagatgaggtagcgcatgccagtcttagaacacctctgtttgatgactatggaggattc |
31417610 |
T |
|
| Q |
156 |
cgttatcaaattgctgtcaaggaattcacaaatacggagcagttacaggtgggtactgggtggtgattggaatagcttgtggagagtgaatgt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31417609 |
cgttatcaaattgctgtcaaggaattcacaaatacggagcagttacaggtgggtactgggtggtgattggaatagcttgtggagagtgaatgt |
31417517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 31417763 - 31417726
Alignment:
| Q |
1 |
aaatttattagtttctaaagtctggttggtttctttgc |
38 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31417763 |
aaatttattaatttctaaagtctggttggtttctttgc |
31417726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University