View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_28 (Length: 247)
Name: NF10437_1D_low_28
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 146 - 224
Target Start/End: Complemental strand, 34384364 - 34384286
Alignment:
| Q |
146 |
gtttcttacaaagagaaggagaagaattacctgtgcaggaattctgaaagcaacacagaaaaggaaattaagaacacca |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34384364 |
gtttcttacaaagagaaggagaagaattacctgtgcaggaattctgaaagcaacacagaaaaggaaattaagaacacca |
34384286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 5 - 81
Target Start/End: Complemental strand, 34384505 - 34384429
Alignment:
| Q |
5 |
cactagaggctcaattgaagctagtactatgtgcaggaataatgatttcttggagcatagaaatactcttgaccagt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34384505 |
cactagaggctcaattgaagctagtactatgtgcaggaataatgatttcttggagcatagaaatactcttgaccagt |
34384429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University