View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10437_1D_low_28 (Length: 247)

Name: NF10437_1D_low_28
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10437_1D_low_28
NF10437_1D_low_28
[»] chr7 (2 HSPs)
chr7 (146-224)||(34384286-34384364)
chr7 (5-81)||(34384429-34384505)


Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 146 - 224
Target Start/End: Complemental strand, 34384364 - 34384286
Alignment:
146 gtttcttacaaagagaaggagaagaattacctgtgcaggaattctgaaagcaacacagaaaaggaaattaagaacacca 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34384364 gtttcttacaaagagaaggagaagaattacctgtgcaggaattctgaaagcaacacagaaaaggaaattaagaacacca 34384286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 5 - 81
Target Start/End: Complemental strand, 34384505 - 34384429
Alignment:
5 cactagaggctcaattgaagctagtactatgtgcaggaataatgatttcttggagcatagaaatactcttgaccagt 81  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34384505 cactagaggctcaattgaagctagtactatgtgcaggaataatgatttcttggagcatagaaatactcttgaccagt 34384429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University