View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_29 (Length: 246)
Name: NF10437_1D_low_29
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 237
Target Start/End: Complemental strand, 32557647 - 32557421
Alignment:
| Q |
11 |
gtattaataacattaataacaatggaaattcctattttaacaacgacaatgttgagcttcctccgttgccaccggatattactagctctgcctgttatag |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32557647 |
gtattaataacattaataataatggaaattcctattttaacaacgacaatgttgagcttcctccgttgccaccggatattactagctctgcctgttatag |
32557548 |
T |
 |
| Q |
111 |
tccaggtgattcagtattcaacggaggcgatcatggttatttttattcatcatgggagcagaatgcatcagaagactgttataataatcaaatgttggga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32557547 |
tccaggtgattcagtattcaacggaggcgatcatggttatttttattcatcatgggagcagaatgcatcagaagattgttataataatcaaatgttggga |
32557448 |
T |
 |
| Q |
211 |
acaaatatgggaggtgcagagaataat |
237 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32557447 |
acaaatatgggaggtgcagagaataat |
32557421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University