View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_31 (Length: 238)
Name: NF10437_1D_low_31
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 52835773 - 52835544
Alignment:
| Q |
1 |
aacagaattaaacagtatcgatacaaatagcagtatattgaagtttctctcatatattctctattttcattctttctgatttctaacaaacttaaactga |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52835773 |
aacagaattaaacagtatcaatacaaatagcagtatattgaagtttctctcatatattctctattttcattctttctgatttctaacaaacttaaactga |
52835674 |
T |
 |
| Q |
101 |
ttggccagatgatatgtcctcttacatctt---------------aaactgatcgagagctttggtctttttcagacatgtggtggtgtatttggttaaa |
185 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52835673 |
ttggcca---gatatgtcctcttacatcttacacacaaggcggggaaaatgatcaagagctttggtctttttcagacatgtggtggtgtatttggttaaa |
52835577 |
T |
 |
| Q |
186 |
agatagttttcctaccaattattagagtatagt |
218 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
52835576 |
agatagttttcctaccaactattagagtatagt |
52835544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University