View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_38 (Length: 222)
Name: NF10437_1D_low_38
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_38 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 222
Target Start/End: Original strand, 30138337 - 30138547
Alignment:
| Q |
12 |
atgaacttgcaactgtgctagctaagactatgaaagcaatgtagggaatgaagattaaggttgttttgaagaatcctgctggaagacagaagaaaactcc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138337 |
atgaacttgcaactgtgctagctaagactatgaaagcaatgtagggaatgaagattaaggttgttttgaagaatcctgctggaagacagaagaaaactcc |
30138436 |
T |
 |
| Q |
112 |
aatgcctgtggatgctgctgtgattagggtttggtattggctgttaaggtggaaagagatgaaagtgaggattggaatggctaaggttaaacctgaagcc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138437 |
aatgcctgtggatgctgctgtgattagggtttggtattggctgttaaggtggaaagagatgaaagtgaggattggaatggctaaggttaaacctgaagcc |
30138536 |
T |
 |
| Q |
212 |
catgcaattga |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
30138537 |
catgcaattga |
30138547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University