View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_39 (Length: 221)
Name: NF10437_1D_low_39
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 23 - 210
Target Start/End: Original strand, 36749556 - 36749740
Alignment:
| Q |
23 |
aattctgccatagtgagactgagccaattttgctattaaactggaccaccacagagtatgttaacgggattgctctgccctagaactagaagcacaccta |
122 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36749556 |
aattctgccatagtgagactgagccaagtttgctattaaactggaccaccacagagtatgttaacgggattgctctgccctagaactagaagcacaccta |
36749655 |
T |
|
| Q |
123 |
agcgaatttgggggatattccatcaacaccgcgagatgacaaccaagtaatcatcatcaacaggtcatcatcactactagaaaaacac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36749656 |
agcgaatttgggggatattccatcaacaccgcgagatgacaaccaagtaatcatcatcaacagg---tcatcactactagaaaaacac |
36749740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University