View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_40 (Length: 220)
Name: NF10437_1D_low_40
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 21 - 217
Target Start/End: Original strand, 27720121 - 27720317
Alignment:
| Q |
21 |
aattaatatgtctttaactctcaaacttctttctattactttcctttccatcatcaccattgtttgtgctcaaaatgccgcgcaaactatcacttatgat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27720121 |
aattaatatgtctttaactctcaaacttttttctattaccttattttccatcatcaccattgtttgtgctcaaaatgccgcgcaaactatcacttatgat |
27720220 |
T |
 |
| Q |
121 |
ggtcgctcactccttcttgatggaaaaggagaacttttcttctccggttccatccattatccacgaagcacccctgatgtatgttacttctttctca |
217 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27720221 |
ggtcgctcactccttctcgatggaaaaggagaacttttcttctccggttccatccattatccacgaagcacccctgatgtatgttacttctttctca |
27720317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 202
Target Start/End: Complemental strand, 55174312 - 55174268
Alignment:
| Q |
158 |
tcttctccggttccatccattatccacgaagcacccctgatgtat |
202 |
Q |
| |
|
|||||||||||||||||||||| | || |||||||||||||||| |
|
|
| T |
55174312 |
tcttctccggttccatccattacactcgcagcacccctgatgtat |
55174268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University