View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_42 (Length: 218)
Name: NF10437_1D_low_42
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 49895589 - 49895385
Alignment:
| Q |
1 |
aattttctctattttcctttgagaatcaatgggttcctttgacttgctttttgtaattgcgaaaagacgccctttttaaaattcaacatgaattgtttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49895589 |
aattttctctattttcctttgagaatcaatgggttcctttgacttgctttttgtaattgcgaaaagacgccctttttaaaattcaacatgaattgtttca |
49895490 |
T |
 |
| Q |
101 |
ggtatctgaaagagccctttacttatggaacaatgaccacattgtcaatttgattgctcacaaccgtcaagtgatactacctatcatatttccagctcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49895489 |
ggtatctgaaagagccctttacttatggaacaatgaccacattgtcaatttgattgctcacaaccgtcaagtgatactacctatcatatttccagctcta |
49895390 |
T |
 |
| Q |
201 |
gagaa |
205 |
Q |
| |
|
||||| |
|
|
| T |
49895389 |
gagaa |
49895385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 82 - 196
Target Start/End: Original strand, 2031780 - 2031894
Alignment:
| Q |
82 |
ttcaacatgaattgtttcaggtatctgaaagagccctttacttatggaacaatgaccacattgtcaatttgattgctcacaaccgtcaagtgatactacc |
181 |
Q |
| |
|
||||||||| | | ||||||||| ||||||| |||||| |||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || || |
|
|
| T |
2031780 |
ttcaacatggactatttcaggtagctgaaaggacccttttcttatggaacaacgaccacattgtaaatttgattgctcataaccgtcaagtgattctgcc |
2031879 |
T |
 |
| Q |
182 |
tatcatatttccagc |
196 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2031880 |
catcatatttccagc |
2031894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University