View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_48 (Length: 212)
Name: NF10437_1D_low_48
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 53788502 - 53788307
Alignment:
| Q |
1 |
gggattgaattttataaattataggatccataaaattcaatatcttaaggttttatgttaaagtgtggtgttcgactcacttatattgggatccccggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| | |||||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
53788502 |
gggattgaattttataaattataggacccataaa-tccaatatcttaaggttttaggttaaagtgtggtgttggactcacttatattgggattcccggtt |
53788404 |
T |
|
| Q |
101 |
ctcacacttcacatcatagcaaagatagagtgagtgggtaccattactcaccacgttttcttagccaaagttcaactctattagtttaagatgatga |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53788403 |
ctcacacttcacatcatagcaaagatagagtgagtgggtaccattactcaccacggtttctcagccaaagttcaactctattagtttaagatgatga |
53788307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University