View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_49 (Length: 211)
Name: NF10437_1D_low_49
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 29105039 - 29104846
Alignment:
| Q |
13 |
gaagccattcagtatattcaccacgttcaccaacttcaaagagccatgcactcgttactcgagctcgaaccatcgtctccgaaactcatccatgcacaaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29105039 |
gaagccattcagtatattcaccacgttaaccaacttcaaagagccatgcactcgttactcgagctcgaaccatcgtctccgaaactcatccatgctcaaa |
29104940 |
T |
|
| Q |
113 |
acctaatgcaaatcgctatgaagaggctccaaaaagagttttaccagatattaaccatgaaccaggcttgcttagacgctgaatccttctctgt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29104939 |
acctaatgcaaatcgctatgaagaggctccaaaaagagttttaccagatattaaccatgaaccaggcctgcttagacgctgaatccttctctgt |
29104846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 12 - 203
Target Start/End: Complemental strand, 29090779 - 29090588
Alignment:
| Q |
12 |
tgaagccattcagtatattcaccacgttcaccaacttcaaagagccatgcactcgttactcgagctcgaaccatcgtctccgaaactcatccatgcacaa |
111 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
29090779 |
tgaagccattcagtacattcaccacgttaaccaacttcaaagagccatgcactcgttactcgagctcgaaccatcgtctccagaactcatccacgcacaa |
29090680 |
T |
|
| Q |
112 |
aacctaatgcaaatcgctatgaagaggctccaaaaagagttttaccagatattaaccatgaaccaggcttgcttagacgctgaatccttctc |
203 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| || |||||||| ||||||||||||||||| | ||||||| ||||||||||||| |
|
|
| T |
29090679 |
aacctaatgcaaattgctatgaagaggctccaaaaagaattctaccagatcttaaccatgaaccaggcatacttagactctgaatccttctc |
29090588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University