View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_53 (Length: 208)
Name: NF10437_1D_low_53
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 16 - 180
Target Start/End: Complemental strand, 41039063 - 41038904
Alignment:
| Q |
16 |
gctcaaattgtctaacctaagtcaaaatgtttcatatatcaagtaattatactggaggtgttgacgtgtcacatttgacattgtgacttgtcaaagttga |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41039063 |
gctcaaattgtctaacgtaagtcaaaatgtttcatatatcaagtaa-----ctggaggtgttgatgtgtcacatttgacattgtgacttgtcaaagttga |
41038969 |
T |
|
| Q |
116 |
tgtcatgacacacgaaacatgtcatagtaaaaatacttttacatataaacaacgttactcattta |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41038968 |
tgtcatgacacacgaaacatgtcatagtaaaaatacttttacatataaacaacgttactcattta |
41038904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University