View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_54 (Length: 208)
Name: NF10437_1D_low_54
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 53617046 - 53616979
Alignment:
| Q |
1 |
gattgaaccctagtccatagacctaaccatatctaatagtgtagccggtggacactaaacaggttgga |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53617046 |
gattgaaccctagtccatagacctaaccatatctaatagtatagccggtggacactaaacaggttgga |
53616979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 92 - 156
Target Start/End: Complemental strand, 53616962 - 53616898
Alignment:
| Q |
92 |
attaatatacaggtttaaatattgacttacataacaataaattttctcttacaagccggccctaa |
156 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53616962 |
attaatctacaggtttaaatattgacttacataacaataaattttctcttacaagccggccctaa |
53616898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University