View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_55 (Length: 207)
Name: NF10437_1D_low_55
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 34384307 - 34384109
Alignment:
| Q |
1 |
gaaaaggaaattaagaacaccacgagagatagcatcagccaaaacagtgagaggattgtagaccccaccacgagaaactttggcaaggaaagcaaacaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34384307 |
gaaaaggaaattaagaacaccacgagagatagcatcagccaaaacagtgagaggattgtagaccccaccacgagaaactttggcaaggaaagcaaacaag |
34384208 |
T |
|
| Q |
101 |
aacatgttgaggatggaaaataaaatctttacaatctcaccgataggggtatgagaaaatccaagaattttgaagacgaataatcgaacgagaacacca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34384207 |
aacatgttgaggatggaaaataaaatctttacaatctcaccgataggggtatgagaaaatccaagaattttgaagacgaataatcgaacgagaacacca |
34384109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University