View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_1D_low_56 (Length: 206)
Name: NF10437_1D_low_56
Description: NF10437_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_1D_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 1315476 - 1315292
Alignment:
| Q |
1 |
attgatatgtcttataagaagaggtgcacgtgtggaactagaggggtcaaatagcatcagcatgccaatctagtaccatagttctattaggaaatgtatt |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1315476 |
attgatatgtcttagaagaagaggtgcacatgtggaactagaggggtcagatagcatcggcatgccaatctagtaccatagttctattaggaaatgtatt |
1315377 |
T |
|
| Q |
101 |
tgcggcttactccagcctaaaaacacatagcagacctagattagacacaaattttaccaaaataaaaagtatcttatcttattct |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1315376 |
tgcggcttactccagcctaaaaacacatagcagacctagattagacacaaattttaccaaaataaaaagtatcttatcttattct |
1315292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University