View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_high_7 (Length: 237)
Name: NF10437_high_7
Description: NF10437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 25 - 226
Target Start/End: Original strand, 8584764 - 8584965
Alignment:
| Q |
25 |
attaggaataacttgagctaatacatgagggctagcaaatttcacatatcttcttttttgaattgtttcctcatcatcaacaccatcatcattttgggtt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8584764 |
attaggaataacttgagctaatacatgagggctagcaaatttcacatatcttcttttttgaattgtttcctcatcatcaacaccatcatcattttgtgtt |
8584863 |
T |
|
| Q |
125 |
ttgatttccacattggttccgttcgcgatgaacttgatgtcttcgtttgtctctggaatatcacgtcgttgaagcaacttcaactctcttgcctttgctt |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
8584864 |
ttgatttccacattggttccgttcgcaatgaacttgatgtcttcgtttgtctctggaatatcacgtcgttgaagcaacttccactctcttgcctttgttt |
8584963 |
T |
|
| Q |
225 |
ct |
226 |
Q |
| |
|
|| |
|
|
| T |
8584964 |
ct |
8584965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University