View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10437_low_7 (Length: 245)
Name: NF10437_low_7
Description: NF10437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10437_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 8 - 232
Target Start/End: Original strand, 34415998 - 34416222
Alignment:
| Q |
8 |
aagcagagagtcttggagtactgccatgatcctaaaactcaacagattatgatggatgagattttgcagtgtgtttccatgctagctcaagatcaatatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34415998 |
aagcagagagtcttggagtactgccatgatcctaaaactcaacagattatgatggatgagattttgcagtgtgtttccatgctagctcaagatcaatatg |
34416097 |
T |
|
| Q |
108 |
ggaactatgttgtacaggttcgttgcatctcaattggtatcgtaaatcgtttgagtatatgaaaccctgaattaattatgaaatttcttcaagtaaaaac |
207 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34416098 |
ggaactatgttgtacaggtttgttgcatctcaattggtatcgtaaatcgtttgagtatatgaaaccctgaattaattatgaaatttcttcaagtaaaaac |
34416197 |
T |
|
| Q |
208 |
taaatgatagtaatagtttgttttg |
232 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34416198 |
taaatgatagtaatagtttgttttg |
34416222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University