View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10438_low_11 (Length: 385)
Name: NF10438_low_11
Description: NF10438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10438_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 359; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 1 - 367
Target Start/End: Complemental strand, 51372348 - 51371982
Alignment:
| Q |
1 |
ttatcacgaaaggaagaaactgggtttcgtacgaaggaaagtgtgtttcgaacgaaatgcaatttgttgtgaaagaaataagtgacacgaattctgtttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51372348 |
ttatcacgaaaggaagaaactgggtttcgtacgaaggaaagtgtgtttcgaacgaaatgcaatttgttgtgaaagaaataagtgacacgaattctgtttc |
51372249 |
T |
|
| Q |
101 |
cgttagtttttgggatgatacggtgacgtttggtaaaaaagtgagacatgagaatattgttaagattatgggaatgtttaggtgtggtaaaagagggtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51372248 |
cgttagtttttgggatgatacggtgacgtttggtaaaaaagtgagacatgagaatattgttaagattatgggaatgtttaggtgtggtaaaagagggtat |
51372149 |
T |
|
| Q |
201 |
ttggtttatgagtttgtagaagggaagagtttaagggaaattatgcatggtttgagttggttaaggagatggaaaattgctttggggattgcaaaagcta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51372148 |
ttggtttatgagtttgtagaagggaagagtttaagggaaattatgcatggtttgagttggttaaggagatggaaaattgctttggggattgcaaaagcta |
51372049 |
T |
|
| Q |
301 |
ttaagtttttgcattgtgaatgtttatggtttggtttggggagcgaagtgtcgccggagacggtttt |
367 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51372048 |
ttaattttttgcattgtgaatgtttgtggtttggtttggggagcgaagtgtcgccggagacggtttt |
51371982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University