View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10438_low_13 (Length: 342)
Name: NF10438_low_13
Description: NF10438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10438_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 42701901 - 42701586
Alignment:
| Q |
1 |
gcagtgcttttaagaatgctcaaacagaagacctcttcacccgttacaaacagggttgggtatgaattttatcatctttcctcacaatctacgtagcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42701901 |
gcagtgcttttaagaatgctcaaacagaagacctcttcacccgttacaaacagggttgggtatgaattttatcatctttcctcacaatctacgtagcact |
42701802 |
T |
|
| Q |
101 |
gagaatttaggtaaaagacatgttcgacactctacgctgcctgatatacatacaacacaaacacttgctggttataacctatcacttttttccttttaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42701801 |
gagaatttaggtaaaagacatgttcgacactctacgctgcctgatatacacacgacacaaacacttgctggttataacctatcacttttttccttttaaa |
42701702 |
T |
|
| Q |
201 |
atcactactaatgtttatgtgacaatatcagtgttgtgtgctgctgctatgtctcacagctcacgagtcacaagtttcaaattttttaacgttagtcttt |
300 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42701701 |
atcactactaatgtttatgtgccaatatcagtgttgtgtgctgctgctatgtctcacagctcacgagtcacaagtttcaaattttttaacgttagtcttt |
42701602 |
T |
|
| Q |
301 |
ctgtcctttgcttctc |
316 |
Q |
| |
|
||||| |||| ||||| |
|
|
| T |
42701601 |
ctgtcttttggttctc |
42701586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University