View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10438_low_19 (Length: 268)
Name: NF10438_low_19
Description: NF10438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10438_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 46072370 - 46072626
Alignment:
| Q |
1 |
acctaaagttgcatcttcttcatttcatccgacaccttgagcacaaaatggttaaccaaacgagttataagaacccnnnnnnntcaatgcaattcatcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46072370 |
acctaaagttgcatcttcttcatttcatctgacaccttgagcacaaaatggttaaccaaacgagttataagaacccaaaaaaatcaatgcaattcatcta |
46072469 |
T |
|
| Q |
101 |
tgtccttgtttatctgctgcaggcaaaggaagatcaattttctaaacattacactaactccttgtggcttttttggtatatatacaaatgtagccgaaaa |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46072470 |
tgtccctgtttatctgctgcaggcaaaggaagatcaattttctaaacattacactaactccttgtggcctttttggtatatatacaaatgtagccgaaaa |
46072569 |
T |
|
| Q |
201 |
gggtaacaaacggatattaatcagcgtctgttgttctctttttcctcctgtgttctt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46072570 |
gggtaacaaacggatattaatcagcgtctgttgttctctttttcctcctgtgttctt |
46072626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University