View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10438_low_21 (Length: 254)
Name: NF10438_low_21
Description: NF10438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10438_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 42701953 - 42702187
Alignment:
| Q |
1 |
tatttgctttcctccattcttttcttaggttcccaagtagaccagccttacaagcattacaattgtagcatagctggttctgatcattgttccacaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42701953 |
tatttgctttcctccattcttttcttaggttcccaagtagaccagccttacaagcattacaattgtagcatagctggttctgatcattgttccacaagtt |
42702052 |
T |
|
| Q |
101 |
gcaatcggaatcagccatgggattcacagggtttgtccacattatgggactcacataactgtatccacaaacagttggaggtttgcaacatcctgactgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42702053 |
gcaatcggaatcagccatgggattcacagggtttgtccacattatgggactcacataactgtatccacaaacagttggaggtttgcaacatcccgactgt |
42702152 |
T |
|
| Q |
201 |
aaataaaaccaatcaaacaaattccttagcgggagt |
236 |
Q |
| |
|
||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
42702153 |
aaa-aaaaccaatcaaacaaattccttagcaggagt |
42702187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University