View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10438_low_24 (Length: 250)
Name: NF10438_low_24
Description: NF10438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10438_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 6 - 166
Target Start/End: Complemental strand, 16006717 - 16006556
Alignment:
| Q |
6 |
gtttgaatcatctattttaatttgaaaaatgctaactattgtctttagacactagttaagaacataaatatattaaaatatcattttatatggtcagata |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16006717 |
gtttgaatcatctattttaatttgaaaaatgctaactattgtctttagacactaattaagaagataaatatattaaaatatcattttgtatggtcagata |
16006618 |
T |
 |
| Q |
106 |
ccataaagatctaaaaat-aaataatcttcaaatcactttgtataatccaatgtcacaaagg |
166 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16006617 |
ccataaagatctaaaaataaaatattcttcaaatcactttgtataatccaatgtcacaaagg |
16006556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University