View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10438_low_27 (Length: 246)
Name: NF10438_low_27
Description: NF10438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10438_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 46072380 - 46072175
Alignment:
| Q |
1 |
caactttaggtattttaaaccgtgttcgaatcagctggggtatatcaactctcagcctctatactgaagtgggagatatattttctgttaagctgccata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46072380 |
caactttaggtattttaaaccgtgttcgaatcagctggggtatatcaactctcagcctctata-----------------ttttctgttaagctgccata |
46072298 |
T |
 |
| Q |
101 |
tttttcattgtaaataaagatgaaaaatttgtatagattcctttattttgtagatgtgttctgccagttttctttatcaaaaggaatatcattcaatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46072297 |
tttttcattgtaaataaagatgaaaaatttgtatagattcctttattttgtagatgtgttctgccagttttctttatcaaaaggaatatcattcaatatt |
46072198 |
T |
 |
| Q |
201 |
tgcatataatttaattaagttta |
223 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
46072197 |
tgcatataatttaattaatttta |
46072175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University