View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10438_low_29 (Length: 239)
Name: NF10438_low_29
Description: NF10438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10438_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 33252142 - 33252364
Alignment:
| Q |
1 |
atctaaggaagcaatatattgaattgaagaagttatatcttgaaattttgtagtgataaggaa-gggtaaggctttcgatctattggaatatcgtcatat |
99 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33252142 |
atctaaggaagcaatatattgaattaaagaagttatatcttgaaattttgcagtgataaggaaagggtaaggctttcgatctattcgaatatcgtcatat |
33252241 |
T |
|
| Q |
100 |
gaaactcacgagttaagaaaaggagtcattctactcaaaatataggatgttgcaattatatttgcattgaggtttatcagtaatctttataaacttggtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33252242 |
gaaactcacgagttaagaaaaggagtcattctactcaa--tataggatgttgcaattatatttgcattgaggtttatcagtaatctttataaacttggtt |
33252339 |
T |
|
| Q |
200 |
cattgtggccaataaccttgggagt |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33252340 |
cattgtggccaataaccttgggagt |
33252364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University