View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10438_low_33 (Length: 207)
Name: NF10438_low_33
Description: NF10438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10438_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 47051412 - 47051321
Alignment:
| Q |
1 |
ctatggtcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcacggtgagtgaacatgttaagacaaatg |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47051412 |
ctatggtcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcatggtgagtgaacatgttaagacaaatg |
47051321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 138 - 202
Target Start/End: Complemental strand, 47051275 - 47051211
Alignment:
| Q |
138 |
atcttggttcagtaaataaatttacacttttgacagtcacatacaattcaactggacatccttat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
47051275 |
atcttggttcagtaaataaatttacacttttgacagccacatacaattcaattggacatccttat |
47051211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 6 - 79
Target Start/End: Original strand, 47929058 - 47929131
Alignment:
| Q |
6 |
gtcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcacggtgagtgaacat |
79 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||| || ||| ||||||||||||| |
|
|
| T |
47929058 |
gtcttttgtggattttaaacatccttcaagcttctcctcttctgcagaaactctctgtcatggtgagtgaacat |
47929131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 14 - 79
Target Start/End: Complemental strand, 48107571 - 48107506
Alignment:
| Q |
14 |
tggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcacggtgagtgaacat |
79 |
Q |
| |
|
|||||||||||||| ||||||| || |||| ||||||||||||||||| || ||||||||||||| |
|
|
| T |
48107571 |
tggattttaaacatccttcaagtttgtccttttttgcagaaactttcagccatggtgagtgaacat |
48107506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 48453503 - 48453451
Alignment:
| Q |
7 |
tcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaacttt |
59 |
Q |
| |
|
|||||| |||||||||||||| || |||| ||||||||||||||||||||||| |
|
|
| T |
48453503 |
tcttttctggattttaaacatcctacaagtttctcctcttttgcagaaacttt |
48453451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 14 - 61
Target Start/End: Original strand, 48895116 - 48895163
Alignment:
| Q |
14 |
tggattttaaacatgcttcaagcttctcctcttttgcagaaactttca |
61 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
48895116 |
tggattttaaacattcttcaagcttgccctcttttgcataaactttca |
48895163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 76
Target Start/End: Complemental strand, 48571222 - 48571156
Alignment:
| Q |
10 |
tttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcacggtgagtgaa |
76 |
Q |
| |
|
||||||||| |||||||| ||| ||||||||||| ||||||||||| | || ||| |||||||||| |
|
|
| T |
48571222 |
tttgtggatcttaaacatccttaaagcttctcctattttgcagaaattgtccctcatggtgagtgaa |
48571156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 7 - 80
Target Start/End: Original strand, 50459595 - 50459668
Alignment:
| Q |
7 |
tcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcacggtgagtgaacatg |
80 |
Q |
| |
|
||||||||||||| | ||||| |||||| ||| ||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
50459595 |
tcttttgtggattctcaacatccttcaaacttttcctcaattgcagaaactttcaatcatggtgagtgaacatg |
50459668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University