View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10439_low_6 (Length: 250)
Name: NF10439_low_6
Description: NF10439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10439_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 27161179 - 27160938
Alignment:
| Q |
1 |
tttgaaaaaattgtgttatttagaaaataaattagtaagaaaccactttgcacacccaaggtcataaaaacgactatttataggttttctaaaaatttgt |
100 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| | |
|
|
| T |
27161179 |
tttgaaaaatttgtgttatttaaaaaataaattaataagaaaccactttgcacacccaaggtcataaaa-cgattatttataggttttctaaaaatttat |
27161081 |
T |
 |
| Q |
101 |
atcttttgtgttcaatcggggatga---aagttaatttccacgagagtctctt-gatgaggataaacatagcacaaagtttgttagaagaagccgcaaat |
196 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27161080 |
atcttttgtgttctatcggggatgatgaaagttaatttccacgagagtctctttgat-aggataaacatagcacaaagtttgttagaagaagccgcaaat |
27160982 |
T |
 |
| Q |
197 |
attttaaatttcataataggaagcaccccatttaaatacctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27160981 |
attttaaatttcataataggaagcaccccatttaaatacctttg |
27160938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University