View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1043_high_11 (Length: 215)

Name: NF1043_high_11
Description: NF1043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1043_high_11
NF1043_high_11
[»] chr7 (1 HSPs)
chr7 (132-194)||(55260-55322)


Alignment Details
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 132 - 194
Target Start/End: Complemental strand, 55322 - 55260
Alignment:
132 caatagttctataacatttgtgtttactactaccacaatttctattaaatataattgatgatg 194  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
55322 caatagttctataacatttgtgtttgctactaccacaatttctattaaatataattgatgatg 55260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University