View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1043_high_6 (Length: 326)
Name: NF1043_high_6
Description: NF1043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1043_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 163 - 306
Target Start/End: Complemental strand, 28609075 - 28608937
Alignment:
| Q |
163 |
actcacaaattaattgannnnnnnaggggcacaatttaactgattttaaattaataatctcatcccatcccattttattgaagtttcgagatacttatag |
262 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28609075 |
actcacaaattaattgatttttttaggggcacaatttaactgattttaaatcaataatc-----ccatcccattttattaaagtttcgagatacttatag |
28608981 |
T |
 |
| Q |
263 |
cttttggattggagcggaaaaattgatcgttgcttgatgtgcaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28608980 |
cttttggattggagcggaaaaattgatcgttgcttgatgtgcaa |
28608937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University