View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1043_low_10 (Length: 326)

Name: NF1043_low_10
Description: NF1043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1043_low_10
NF1043_low_10
[»] chr7 (1 HSPs)
chr7 (163-306)||(28608937-28609075)


Alignment Details
Target: chr7 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 163 - 306
Target Start/End: Complemental strand, 28609075 - 28608937
Alignment:
163 actcacaaattaattgannnnnnnaggggcacaatttaactgattttaaattaataatctcatcccatcccattttattgaagtttcgagatacttatag 262  Q
    |||||||||||||||||       ||||||||||||||||||||||||||| |||||||     ||||||||||||||| ||||||||||||||||||||    
28609075 actcacaaattaattgatttttttaggggcacaatttaactgattttaaatcaataatc-----ccatcccattttattaaagtttcgagatacttatag 28608981  T
263 cttttggattggagcggaaaaattgatcgttgcttgatgtgcaa 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
28608980 cttttggattggagcggaaaaattgatcgttgcttgatgtgcaa 28608937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University