View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1043_low_11 (Length: 325)
Name: NF1043_low_11
Description: NF1043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1043_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 17 - 308
Target Start/End: Complemental strand, 36490223 - 36489929
Alignment:
| Q |
17 |
caaatcaatatatgcgcatccttctcttgtttagtaattttattccactgtgacttggatctccacttatctgataatgtgttattaactttttctttac |
116 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36490223 |
caaatcaatatatgcgcatccttcttttgtttagtaattttattccactgtgacttggatctccacttatccgataatgtgttattaactttttctttac |
36490124 |
T |
 |
| Q |
117 |
ttaaaattctcacagtcctgatgatcgaggaactaataat---tttatttttatctacattggatatttttaattaaatgttcagtcccataaaactgta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36490123 |
ttaaaattctcacagtcctgatgatcgaggaactaataatatttttttttttatctacattggatatttttaattaaatgttcagtcccataaaactgta |
36490024 |
T |
 |
| Q |
214 |
gaaaagtgtagcacaaagagaaagaacattgcagatatatcaccttcatattaattatatatctaactatcaaatatgtcacccttgccttttcc |
308 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36490023 |
gaaaagtgtagcacaaagagatagaacattgcagatatatcaccttcatattaattatatatctaactatcaaatatgtcacccttgccttttcc |
36489929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University