View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1043_low_12 (Length: 320)
Name: NF1043_low_12
Description: NF1043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1043_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 243 - 299
Target Start/End: Original strand, 18645752 - 18645808
Alignment:
| Q |
243 |
agttcggttgatgatctaagcgatactaaaggagtttaaagcacatttgctattata |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18645752 |
agttcggttgatgatctaagcgatactaaaggagtttaaagcacatttgctattata |
18645808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University