View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1043_low_13 (Length: 314)
Name: NF1043_low_13
Description: NF1043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1043_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 157 - 295
Target Start/End: Complemental strand, 44309539 - 44309401
Alignment:
| Q |
157 |
ttttgttgaaattcattttaactcaaccctcctcttcaaacatatctgcaaccaatttttccttatccaatgcaacatcaaaaagtctactaaattgatg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44309539 |
ttttgttgaaattcattttaactcaaccctcctcttcaaacatatctgcaaccaatttttccttatccaatgcaacatcaaaaagtctactaaattgatg |
44309440 |
T |
|
| Q |
257 |
acgcaaaatgcatatctattaatgacgaaaaatgttgca |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44309439 |
acgcaaaatgtatatctattaatgacgaaaaatgttgca |
44309401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 60 - 160
Target Start/End: Complemental strand, 44310078 - 44309978
Alignment:
| Q |
60 |
acaattatgtcaatctctttcacaatggactggtggtagttcatagtatgcatctcaagacaaggtttttggaaagctattatgagaagttggacctttt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44310078 |
acaattatgtcaatctctttcacaatggactggtggtagttcatagtatgcatctcaagacaaggtttttggaaagctattatgagaagttggacctttt |
44309979 |
T |
|
| Q |
160 |
t |
160 |
Q |
| |
|
| |
|
|
| T |
44309978 |
t |
44309978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 62
Target Start/End: Complemental strand, 44310126 - 44310094
Alignment:
| Q |
30 |
gctttgatgttataggtttcctatagctgaaca |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44310126 |
gctttgatgttataggtttcctatagctgaaca |
44310094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 115 - 308
Target Start/End: Complemental strand, 18701354 - 18701145
Alignment:
| Q |
115 |
caagacaaggtttttggaaagctattatgagaagttggacctttttgtt----------------gaaattcattttaactcaaccctcctcttcaaaca |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18701354 |
caagacaaggtttttggaaagctattatgagaagttggacctttttattttatttactgtctattgaaattcattttaactcaaccctcctcttcaaaca |
18701255 |
T |
|
| Q |
199 |
tatctgcaaccaatttttccttatccaatgcaacatcaaaaagtctactaaattgatgacgcaaaatgcatatctattaatgacgaaaaatgttgcaggg |
298 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
18701254 |
tatctgcaaccaatttttacttatccaacgcaacatcaaaaagtctactaaattgatgacacaaaatgtatatctattaatgacgaaaaatgttccaggg |
18701155 |
T |
|
| Q |
299 |
cctttgcttc |
308 |
Q |
| |
|
|||||||||| |
|
|
| T |
18701154 |
cctttgcttc |
18701145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University