View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1043_low_15 (Length: 259)
Name: NF1043_low_15
Description: NF1043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1043_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 6634522 - 6634765
Alignment:
| Q |
1 |
tgttatttgttctgctagcgttggaccaaattaaggtttgcataggtgtaattgaactataggcctatagctgtttattttgttctcctgtgtctgctat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6634522 |
tgttatttgttctgctagcgttggaccaaattaaggtttgcataggtgtaattgaactataggcctatagctgtttattttgttctcctgtgtctgctat |
6634621 |
T |
 |
| Q |
101 |
aattggagttctgtata-tggtaacttagtttggctgcattgatnnnnnnnnngataa-------ttttggtcataggaaacagctttggcaacataatt |
192 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||| ||||| ||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
6634622 |
aattggagttctgtatattggtcacttagtttggctgcattgat-aaaaaaaagataaattaagtttttggttataggaaacagctctggcaacataatt |
6634720 |
T |
 |
| Q |
193 |
tggttttctgttttaaccttcttccaagaatggtaatattgatga |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6634721 |
tggttttctgttttaaccttcttccaagaatggtaatattgatga |
6634765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University