View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1043_low_18 (Length: 250)
Name: NF1043_low_18
Description: NF1043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1043_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 32874476 - 32874239
Alignment:
| Q |
1 |
cataaacactatatatttggtcttgtgacgattcaagatttgctcgtcataaacactatatatttgatcttgtgacaattcaagacttgcttgtcaggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||| |||||||||||||||||||||||| |||| ||| |
|
|
| T |
32874476 |
cataaacactatatatttggtcttgtgacgaatcaagatttgctcgacataaacattatatatttggtcttgtgacaattcaagacttgctcgtcatgaa |
32874377 |
T |
|
| Q |
101 |
gagatgtgcaatttttgccaacaaagtataacggcgaaactcaaacatacaaagtgttgatgattgaagagttgcgtgtttgaacccatgtccatcatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32874376 |
gagatgtgcaatttttgccaacaaagtataacaacgaaactcaaacatacaaagtgttgatgattgaagagttgcgtgtttgaacccttgtccatcatat |
32874277 |
T |
|
| Q |
201 |
taaaggttcatgcaactttttatcacatgagttctatt |
238 |
Q |
| |
|
|||| ||||||| || |||||||| |||||||| |||| |
|
|
| T |
32874276 |
taaatgttcatgtaaatttttatcccatgagttatatt |
32874239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University