View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1043_low_19 (Length: 247)
Name: NF1043_low_19
Description: NF1043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1043_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 18645565 - 18645340
Alignment:
| Q |
1 |
acaacaggagaggctacttgcaggctataatgacatggatactatgaccgaaacatgactttttccaggaagtcttaccgagttagattgttt----tat |
96 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |||||||||| | | |
|
|
| T |
18645565 |
acaacaggagaagctccttgagggctataatgacatggatactatgactgaaacaggactttttccaggaagtcttaccgaggtagattgtttattttgt |
18645466 |
T |
|
| Q |
97 |
caccataattgcgggcgcgattgttatcaatgtgtcaccaataacacgactgaaacacgctccttgattttgtagcaaatgtggccaatgcggaagcaat |
196 |
Q |
| |
|
||||||||||||||||||||||| || ||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18645465 |
caccataattgcgggcgcgattgataccaatgtgccaccaataacacgactgaaaaacgctccttgattttgtagcaaatgtggccaatgcggaagcaat |
18645366 |
T |
|
| Q |
197 |
ttctgttgtcatttcatcacagagac |
222 |
Q |
| |
|
||||||||||||||||| |||||||| |
|
|
| T |
18645365 |
ttctgttgtcatttcattacagagac |
18645340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University