View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1043_low_20 (Length: 246)
Name: NF1043_low_20
Description: NF1043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1043_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 9 - 236
Target Start/End: Complemental strand, 36490151 - 36489921
Alignment:
| Q |
9 |
gataatgttttattaactttttctttacttaaatttctcacagtcctgatgatcgaggaactaataat---tttatttttatctacatgggatattttta |
105 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||||||| |
|
|
| T |
36490151 |
gataatgtgttattaactttttctttacttaaaattctcacagtcctgatgatcgaggaactaataatatttttttttttatctacattggatattttta |
36490052 |
T |
|
| Q |
106 |
ataaaatgttcagtcccataaaactgtaaaaaagtgtagcaaaaagagaaagaacattgcagatatatccccttcatattaattatatatctaactataa |
205 |
Q |
| |
|
|| ||||||||||||||||||||||||| |||||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
36490051 |
attaaatgttcagtcccataaaactgtagaaaagtgtagcacaaagagatagaacattgcagatatatcaccttcatattaattatatatctaactatca |
36489952 |
T |
|
| Q |
206 |
aatatgtcccccttgccttttcccgcctatg |
236 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |
|
|
| T |
36489951 |
aatatgtcacccttgccttttcccgcctatg |
36489921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University