View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1043_low_22 (Length: 225)
Name: NF1043_low_22
Description: NF1043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1043_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 82 - 190
Target Start/End: Complemental strand, 2489524 - 2489416
Alignment:
| Q |
82 |
atactttggtttcttactcacaatctgcctttatgtgcttagaatctctaaatatctatttcattcattttgattttaaattagaaacttctccaagcct |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2489524 |
atactttggtttcttactcacaatctgcctttatgtgcttcgaatctctaaatatctatttcattcattttgattttaaattagaaacttctcgaagcct |
2489425 |
T |
|
| Q |
182 |
ggtgaaatg |
190 |
Q |
| |
|
||||||||| |
|
|
| T |
2489424 |
ggtgaaatg |
2489416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 133 - 189
Target Start/End: Complemental strand, 5034609 - 5034553
Alignment:
| Q |
133 |
atatctatttcattcattttgattttaaattagaaacttctccaagcctggtgaaat |
189 |
Q |
| |
|
||||||||||||||||| ||||| | ||||||||||||||||||||| ||||||||| |
|
|
| T |
5034609 |
atatctatttcattcatattgatgtgaaattagaaacttctccaagcatggtgaaat |
5034553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University