View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1043_low_23 (Length: 219)
Name: NF1043_low_23
Description: NF1043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1043_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 199
Target Start/End: Original strand, 49827055 - 49827242
Alignment:
| Q |
12 |
atgaactgcattatctgattcttttttctgctttcaggttaatattggtgcagatcacagagtcttggacggagcaacagttgcaagattttgcaacgag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49827055 |
atgaactgcattatctgattcttttttctgctttcaggttaatattggtgcagatcacagagtcttggacggagcaacagttgcaagattttgcaacgag |
49827154 |
T |
 |
| Q |
112 |
tggaagaaattaattgaaaatccagagttactcgtgttgcatttgaaatgagatttgattataaaggacacttgttgtaattgtaatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49827155 |
tggaagaaattaattgaaaatccagagttactcgtgttgcatttgaaatgagatttgattataaaggacacttgttgtaattgtaatt |
49827242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University