View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1043_low_28 (Length: 206)
Name: NF1043_low_28
Description: NF1043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1043_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 49827232 - 49827055
Alignment:
| Q |
16 |
acaacaagtgtcctttataatcaaatctcatttcaaatgcaacacgagtaactctggattttcaattaatttcttccactcgttgcaaaatcttgtaact |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49827232 |
acaacaagtgtcctttataatcaaatctcatttcaaatgcaacacgagtaactctggattttcaattaatttcttccactcgttgcaaaatcttgcaact |
49827133 |
T |
 |
| Q |
116 |
gttgctccgtccaagactctgtgatctgcaccaatattaacctgaaagcagaaaaaagaatcagataatgcagttcat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49827132 |
gttgctccgtccaagactctgtgatctgcaccaatattaacctgaaagcagaaaaaagaatcagataatgcagttcat |
49827055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University