View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10440_high_3 (Length: 410)
Name: NF10440_high_3
Description: NF10440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10440_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 12 - 373
Target Start/End: Complemental strand, 37597196 - 37596835
Alignment:
| Q |
12 |
aagcaaaggaatcgaatcgtatgaggtggacggtggaaagaaagatgtgatgggtttgtgggactaacattgtctttgagtggggcctactttttattgg |
111 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37597196 |
aagcaaaggaatcgaattgtatgaggtggacggtggaaagaaagatgtgatgggtttgtgggactaccattgtctttgagtggggcctactttttattgg |
37597097 |
T |
|
| Q |
112 |
tgcatgttgagaagaaagaaagtggaagagaagcattgcagtgcaggcatttcaaaaacatgagatttgcatcatcaatgaacggtggtggcttgtttcg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37597096 |
tgcatgttgagaagaaagaaagtggaagagaagcattgcagtgcaggcatttcaaaaacatgagatttgcagcatcaatgaacggtggtggcttgtttcg |
37596997 |
T |
|
| Q |
212 |
gaaagtaggaatttcaagtggatactttccttcattcatagtattcggtttgggaaatgccatagccatcttgtgaccttacatgcacaccattcacacc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
37596996 |
gaaagtaggaatttcaagtggatactttccttcattcatagtattcggtttgggaaatgccaaagtcatcttgtgaccttacatgcacaccattcacacc |
37596897 |
T |
|
| Q |
312 |
aatgcagccaattatcatctcacgtgcccgtcaaattatatgtgagcagtaggggatcttga |
373 |
Q |
| |
|
|||||||||||||||||||||||||| || | |||||||| |||||||||| ||||||||| |
|
|
| T |
37596896 |
aatgcagccaattatcatctcacgtggccataaaattataaatgagcagtagcggatcttga |
37596835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University