View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10440_high_6 (Length: 253)
Name: NF10440_high_6
Description: NF10440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10440_high_6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 36683054 - 36682821
Alignment:
| Q |
17 |
gaacaacaagcacatagaggtaatattttttgagccaccacaggacctcgacacagttcatggacggtcatggggtggtacgaaattaaattatctatat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36683054 |
gaacaacaagcacatagaggtaatattttttgagccaccacaggacctcgacacagttcatggacggtcatggggtgatacgaaattaaattatctatat |
36682955 |
T |
|
| Q |
117 |
catttatttgtctgaggctactaaatatcatattcagtttgtatgatgatcatcgggagaccatgaccttataggaggagatatgctagtactagggatg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36682954 |
catttatttgtctgaggctactaaatatcatattcagtttgtatgatgatcatcgggagaccatgaccttataggaggagatatgctagtactaggg--- |
36682858 |
T |
|
| Q |
217 |
atgaattatgtgcggtcaagggaaggttaccaccact |
253 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36682857 |
atgaattatgtgcagtcaagggaaggttaccaccact |
36682821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 17 - 152
Target Start/End: Complemental strand, 436218 - 436085
Alignment:
| Q |
17 |
gaacaacaagcacatagaggtaatattttttgagccaccacaggacctcgacacagttcatggacggtcatggggtggtacgaaattaaattatctatat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
436218 |
gaacaacaagcacatagaggtaatattttttgagccaccat-ggacctcgacacagttcatggacggtcatggggtggtacgaaattaaattatctatat |
436120 |
T |
|
| Q |
117 |
catttatttgtctgaggctactaaatatcatattca |
152 |
Q |
| |
|
|| |||||| |||||||||||||||||||||||||| |
|
|
| T |
436119 |
ca-ttatttatctgaggctactaaatatcatattca |
436085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 220 - 253
Target Start/End: Complemental strand, 436085 - 436052
Alignment:
| Q |
220 |
aattatgtgcggtcaagggaaggttaccaccact |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
436085 |
aattatgtgcggtcaagggaaggttaccaccact |
436052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University