View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10440_low_18 (Length: 223)
Name: NF10440_low_18
Description: NF10440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10440_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 44989867 - 44989747
Alignment:
| Q |
1 |
gaatgacagacatataatgaggtttcttggatagaccacagacagagttgcataccagatcaaaataaaacctagccgagcccaactgagactccctaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
44989867 |
gaatgacagacatataatgaggtttcttggatagaccagagacatagttgcataccagatc--aataa--------------taactgagactccctaaa |
44989784 |
T |
 |
| Q |
101 |
gacacaaagtcctagagcaatctcaccgaatagcaaa |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44989783 |
gacacaaagtcctagagcaatctcaccgaatagcaaa |
44989747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 178 - 210
Target Start/End: Complemental strand, 44989749 - 44989717
Alignment:
| Q |
178 |
aaaacaatatgactgacttaatttataagatat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44989749 |
aaaacaatatgactgacttaatttataagatat |
44989717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University