View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10440_low_19 (Length: 216)
Name: NF10440_low_19
Description: NF10440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10440_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 24 - 205
Target Start/End: Complemental strand, 48183814 - 48183633
Alignment:
| Q |
24 |
tgatggacctttcagccaccacgttcacgttttcaaaatcgataaataagtaatgatgttgcgaatgtttatgttttgttataactaggaactctgcatt |
123 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48183814 |
tgatggacctttcagccaccacgtttacgttttcaaaatcgataaataagtcatgatgttgcgaatgtttatgttttgttataactaggaactctgcatt |
48183715 |
T |
|
| Q |
124 |
atggttgcttacttttcgtatctatgaacaatgcttctactttgttatttcccttgatttgctcatttgtggcctatgcttc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48183714 |
atggttgcttacttttcgtatctatgaacaatgcttctactttgttatttcccttgatttgctcatttgtggccaatgcttc |
48183633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 60
Target Start/End: Original strand, 20266495 - 20266531
Alignment:
| Q |
24 |
tgatggacctttcagccaccacgttcacgttttcaaa |
60 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
20266495 |
tgatggacctttcagccactacgttcatgttttcaaa |
20266531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University