View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10441_high_14 (Length: 356)
Name: NF10441_high_14
Description: NF10441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10441_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 17 - 347
Target Start/End: Original strand, 2451552 - 2451882
Alignment:
| Q |
17 |
atatttccctagcacaaaactctcctcaagatttccttgaggtacataatcaagctcgagatgaggttggtgttggtccactttattgggaccaaaccct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2451552 |
atatttccctagcacaaaactctcctcaagattttcttgaggtacataatcaagctcgagatgaggttggtgttggtccactttattgggagcaaaccct |
2451651 |
T |
 |
| Q |
117 |
tgaagcctatgctcaaaattatgcaaacaagagaataaaaaattgtgagcttgaacactctatgggcccttatggtgagaaccttgccgagggttatggt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2451652 |
tgaagcctatgctcaaaattatgcaaacaagagaatcaaaaattgtgagcttgaacactctatgggcccttatggtgagaaccttgctgagggttatggt |
2451751 |
T |
 |
| Q |
217 |
gaagtgaatggtacggattcagtgaagttttggctaagtgaaaagcctaattatgattataactctaactcttgtgttaatgatgagtgtgggcattata |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2451752 |
gaagtgaatggtacggattcagtgaagttttggctaagtgaaaagcctaattatgattataactctaactcttgtgttaatgatgagtgtgggcattata |
2451851 |
T |
 |
| Q |
317 |
ctcaaattatttggcgtgattctgttcatct |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2451852 |
ctcaaattatttggcgtgattctgttcatct |
2451882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University