View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10441_high_24 (Length: 266)
Name: NF10441_high_24
Description: NF10441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10441_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 8e-30; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 157 - 251
Target Start/End: Complemental strand, 28039206 - 28039112
Alignment:
| Q |
157 |
gtatgtttggattgaatgcgagtttgatgaaattggtnnnnnnnncataagcatataattctattgacatgatgttaaccgtgaattgtacgtgc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28039206 |
gtatgtttggattgaatgcgagtttgatgaaattggtaaaaaaaacataagcatataattctattgacatgatgtgaaccgtgaattgtacgtgc |
28039112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 59 - 107
Target Start/End: Complemental strand, 28071071 - 28071023
Alignment:
| Q |
59 |
tacttttagatggtttatttggttattcatatatttatttattaaactc |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28071071 |
tacttttagatggtttatttgtttattcatatatttatttattaaactc |
28071023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 59 - 107
Target Start/End: Original strand, 50064080 - 50064128
Alignment:
| Q |
59 |
tacttttagatggtttatttggttattcatatatttatttattaaactc |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50064080 |
tacttttagatggtttatttgtttattcatatatttatttattaaactc |
50064128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 59 - 107
Target Start/End: Complemental strand, 2035157 - 2035109
Alignment:
| Q |
59 |
tacttttagatggtttatttggttattcatatatttatttattaaactc |
107 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2035157 |
tacttttagatgatttatttgtttattcatatatttatttattaaactc |
2035109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 28071138 - 28071102
Alignment:
| Q |
1 |
tgaataacacacgtatgcgcagcttcactcttcattc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28071138 |
tgaataacacacgtatgcgcagcttcactcttcattc |
28071102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 62; Significance: 7e-27; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 59 - 149
Target Start/End: Complemental strand, 30639582 - 30639492
Alignment:
| Q |
59 |
tacttttagatggtttatttggttattcatatatttatttattaaactcaaacnnnnnnncgtgtgcattcatctcttatttattaagtat |
149 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30639582 |
tacttttagatggtttatttgtttattcatatatttatttattaaactcaaacaaaaaaaagtgtgcattcatctcttatttattaagtat |
30639492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 62 - 106
Target Start/End: Complemental strand, 3185734 - 3185690
Alignment:
| Q |
62 |
ttttagatggtttatttggttattcatatatttatttattaaact |
106 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3185734 |
ttttagatggtttatttgtttattcatatatttatttattaaact |
3185690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 102
Target Start/End: Complemental strand, 12228 - 12188
Alignment:
| Q |
62 |
ttttagatggtttatttggttattcatatatttatttatta |
102 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
12228 |
ttttagatgttttatttgtttattcatatatttatttatta |
12188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 30641428 - 30641396
Alignment:
| Q |
1 |
tgaataacacacgtatgcgcagcttcactcttc |
33 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
30641428 |
tgaataacacacgtatacgcagcttcactcttc |
30641396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 59 - 104
Target Start/End: Original strand, 29669096 - 29669141
Alignment:
| Q |
59 |
tacttttagatggtttatttggttattcatatatttatttattaaa |
104 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29669096 |
tacttttagatggtttatttgtttattcatatatttatttattaaa |
29669141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 59 - 106
Target Start/End: Original strand, 33881076 - 33881123
Alignment:
| Q |
59 |
tacttttagatggtttatttggttattcatatatttatttattaaact |
106 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
33881076 |
tacttttagatggtttatttgtttattcatatatttatatattaaact |
33881123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 7839406 - 7839358
Alignment:
| Q |
62 |
ttttagatggtttatttggttattcatatatttatttattaaactcaaac |
111 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7839406 |
ttttagatgattt-tttgtttattcatatatttatttattaaactcaaac |
7839358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 120 - 149
Target Start/End: Original strand, 13958778 - 13958807
Alignment:
| Q |
120 |
gtgtgcattcatctcttatttattaagtat |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13958778 |
gtgtgcattcatctcttatttattaagtat |
13958807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 59 - 106
Target Start/End: Complemental strand, 14434801 - 14434754
Alignment:
| Q |
59 |
tacttttagatggtttatttggttattcatatatttatttattaaact |
106 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14434801 |
tacttttagatggtttatttatttattcatatatttatttattaaact |
14434754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 156
Target Start/End: Original strand, 11017142 - 11017178
Alignment:
| Q |
120 |
gtgtgcattcatctcttatttattaagtatcctcgtg |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11017142 |
gtgtgcattcatctcttatttattaagtatccgcgtg |
11017178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 37
Target Start/End: Complemental strand, 14435173 - 14435143
Alignment:
| Q |
7 |
acacacgtatgcgcagcttcactcttcattc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14435173 |
acacacgtatgcgcagcttcactcttcattc |
14435143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 102
Target Start/End: Complemental strand, 9308737 - 9308697
Alignment:
| Q |
62 |
ttttagatggtttatttggttattcatatatttatttatta |
102 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
9308737 |
ttttagatggtttatttgtttatttatatatttatttatta |
9308697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University