View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10441_high_35 (Length: 238)
Name: NF10441_high_35
Description: NF10441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10441_high_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 4610782 - 4610966
Alignment:
| Q |
1 |
ttcccctttcttttgtaaccaagtggtttacatctagtaaagaatttggtttggtttcttttaaagaatacaactctgtactcatagcaattgttatcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4610782 |
ttcccctttcttttgtaaccaagtggtttacatctagtaaagaatttggtttggtttcttttaaagaatacaactctgtactcatagcaattgttatcag |
4610881 |
T |
 |
| Q |
101 |
taccttacgatacacgccattcatatctcatttcaatgcagaactagatcgaatcaatacgaatttctaatgtgtatcgcgagcc |
185 |
Q |
| |
|
|||||||||||||| || | || ||||||||||||||||| |||| |||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
4610882 |
taccttacgatacatgcgactcgtatctcatttcaatgcaaaactggatcaaatcaatacgaatttctagtgtgtatcgcgagcc |
4610966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University