View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10441_low_15 (Length: 391)
Name: NF10441_low_15
Description: NF10441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10441_low_15 |
 |  |
|
| [»] scaffold0082 (1 HSPs) |
 |  |  |
|
| [»] scaffold2041 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0082 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 14 - 321
Target Start/End: Complemental strand, 19124 - 18817
Alignment:
| Q |
14 |
aggccttatggaagtcggggctcgtccccggtcaatattggatcaaacaatagagggccgtagcactgacctatttattannnnnnnnattcaatacagg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19124 |
aggccttatggaagtcggggctcgtccccggtcaatattggatcaaacaatagagggccgtagcactgacctatttattattttttttattcaatacagg |
19025 |
T |
 |
| Q |
114 |
gaaaagatcgtaaagttccctaccgatacaacagacactctcaacggatcctccgcgctccgggcatacctcttccttctgtgcgtctttctcgtggcgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19024 |
gaaaagatcgtaaagttccctaccgatacaacagacactctcaacggatcctccgcgctccgggcatacctcttccttctgtgcgtctttctcgtggcgg |
18925 |
T |
 |
| Q |
214 |
gaacagaacaacagggaaagacccggccgacctgcccaaggctcgagggcgagctttatttaagagataatggggagtgaatcgaaaggcttccgttttc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18924 |
gaacagaacaacagggaaagacccggccgacctgcccaaggctcgagggcgagctttatttaagagataatggggagtgaatcgaaaggcttccgttttc |
18825 |
T |
 |
| Q |
314 |
gttcttgg |
321 |
Q |
| |
|
|||||||| |
|
|
| T |
18824 |
gttcttgg |
18817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 188 - 289
Target Start/End: Original strand, 42050544 - 42050645
Alignment:
| Q |
188 |
ccttctgtgcgtctttctcgtggcgggaacagaacaacagggaaagacccggccgacctgcccaaggctcgagggcgagctttatttaagagataatggg |
287 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||| ||||||| ||| ||||||| |||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
42050544 |
ccttttgtgcgtctttctcgtggcgggaacattacaacaaggaaagatccgtccgacctacccaaggctcaagggcgagctttatttaagagacaatggg |
42050643 |
T |
 |
| Q |
288 |
ga |
289 |
Q |
| |
|
|| |
|
|
| T |
42050644 |
ga |
42050645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2041 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold2041
Description:
Target: scaffold2041; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 378
Target Start/End: Original strand, 579 - 616
Alignment:
| Q |
341 |
ggtaccaaaagtttcgatttgatttagatgatttctgt |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
579 |
ggtaccaaaagtttcgatttgatttagatgatttctgt |
616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University