View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10441_low_28 (Length: 333)
Name: NF10441_low_28
Description: NF10441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10441_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 19 - 320
Target Start/End: Complemental strand, 2117521 - 2117218
Alignment:
| Q |
19 |
cttgggaagaaatcatttaatctcttgt--ccacgagaagagatacgggaaaatgacagaaattagggtttattgttgaaggttaatttcgtttaactca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2117521 |
cttgggaagaaatcatttaatctcttgtgtccacgagaagagatacaggaaaatgacataaattagggtttattgttgaaggttaatttcgtgtaactca |
2117422 |
T |
 |
| Q |
117 |
cgcttggaccttcaatacaaaagtggttcggattccatgcactctctttgtttttgttttagaatctttctcaatttgtccttcaatacaaaagtacctc |
216 |
Q |
| |
|
|| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2117421 |
tgcctggacattcaatacaaaagtggttcgaattccatgcactctctttgtttttgttttagaatctttctcaatttgtccttcaatacaaaagtacctc |
2117322 |
T |
 |
| Q |
217 |
acgcctggacctttataaacgtccattgctttctaacaagctctgataaaccttcttactttcattccatcccactaattagtatcttctgccaattgtt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2117321 |
acgcctggacctttataaacgtccattgctttctaacaagctctgataaaccttcttactttcattccatcccactaattagtatcttctgccaattgtt |
2117222 |
T |
 |
| Q |
317 |
tctt |
320 |
Q |
| |
|
|||| |
|
|
| T |
2117221 |
tctt |
2117218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 74 - 106
Target Start/End: Complemental strand, 38860497 - 38860465
Alignment:
| Q |
74 |
agaaattagggtttattgttgaaggttaatttc |
106 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
38860497 |
agaaattagggtttattgttgaaggctaatttc |
38860465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University