View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10441_low_49 (Length: 251)
Name: NF10441_low_49
Description: NF10441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10441_low_49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 35186496 - 35186257
Alignment:
| Q |
1 |
tatgtctatggattgaaattacatgaatcactaatggtaaatttatgttgcagggtaaagtagtgtgccgattaggcatttgcaaattttggttggttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35186496 |
tatgtctatggattgaaattacatgaatcactaatggtaaatttatgttgcagggtaaagtagtgtaccgattaggcatttgcaaattttggttggttat |
35186397 |
T |
|
| Q |
101 |
atattctgtcttcacttaattgttcagaataaacttgtaactttttccactttatgcttggcagtgtgctttccggcgtcagttctggctacgctaaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35186396 |
atattctgtcttcacttaattgttcagaataaacttgtaactttttccactttatgcttggcagtgtgctttccggcgtcagttctggctacgctaaaaa |
35186297 |
T |
|
| Q |
201 |
gttgacatttggagcataacatatagtttggatttttcat |
240 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35186296 |
gttgacattcggagcataacatatagtttggatttttcat |
35186257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 20511270 - 20511183
Alignment:
| Q |
1 |
tatgtctatggattgaaattacatgaatcactaatggtaaatttatgttgcagggtaaagtagtgtgccgattaggcatttgcaaatt |
88 |
Q |
| |
|
||||||||||||||||||||| ||||| ||| ||| ||||||| ||||||||| ||||| || ||| |||| |||||||||||||| |
|
|
| T |
20511270 |
tatgtctatggattgaaattatgtgaatgactgatgataaatttctgttgcaggctaaagccgtttgcagatttggcatttgcaaatt |
20511183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University