View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10441_low_49 (Length: 251)

Name: NF10441_low_49
Description: NF10441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10441_low_49
NF10441_low_49
[»] chr2 (1 HSPs)
chr2 (1-240)||(35186257-35186496)
[»] chr8 (1 HSPs)
chr8 (1-88)||(20511183-20511270)


Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 35186496 - 35186257
Alignment:
1 tatgtctatggattgaaattacatgaatcactaatggtaaatttatgttgcagggtaaagtagtgtgccgattaggcatttgcaaattttggttggttat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
35186496 tatgtctatggattgaaattacatgaatcactaatggtaaatttatgttgcagggtaaagtagtgtaccgattaggcatttgcaaattttggttggttat 35186397  T
101 atattctgtcttcacttaattgttcagaataaacttgtaactttttccactttatgcttggcagtgtgctttccggcgtcagttctggctacgctaaaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35186396 atattctgtcttcacttaattgttcagaataaacttgtaactttttccactttatgcttggcagtgtgctttccggcgtcagttctggctacgctaaaaa 35186297  T
201 gttgacatttggagcataacatatagtttggatttttcat 240  Q
    ||||||||| ||||||||||||||||||||||||||||||    
35186296 gttgacattcggagcataacatatagtttggatttttcat 35186257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 20511270 - 20511183
Alignment:
1 tatgtctatggattgaaattacatgaatcactaatggtaaatttatgttgcagggtaaagtagtgtgccgattaggcatttgcaaatt 88  Q
    |||||||||||||||||||||  ||||| ||| ||| ||||||| ||||||||| |||||  || ||| |||| ||||||||||||||    
20511270 tatgtctatggattgaaattatgtgaatgactgatgataaatttctgttgcaggctaaagccgtttgcagatttggcatttgcaaatt 20511183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University