View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10441_low_51 (Length: 250)
Name: NF10441_low_51
Description: NF10441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10441_low_51 |
 |  |
|
| [»] scaffold0061 (1 HSPs) |
 |  |  |
|
| [»] scaffold0017 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 26728655 - 26728886
Alignment:
| Q |
1 |
ccaaacacaaaacgacttatctgagctttccctttcaaatgtaagtaatttggcgcaaatacctcaatggttttggggaaaattgcaaacactagaacta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26728655 |
ccaaacacaaaacgacttatctgagctttccctttcaaatgtaggtaatttggcgcaaatacctcaatggttttggggaaaattgcaaacactagaacta |
26728754 |
T |
 |
| Q |
101 |
ttgaacatttcaaacaacaatctcagtggtaggattccagatatggaactcaatctaacccattatcttgaactagatttgagttcaaatcaactcgaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26728755 |
ttgaacatttcaaacaacaatctcagtggtaggattccagatatggaactcaatctaacccattatcttgaactagatttgagttcaaatcaactcgaag |
26728854 |
T |
 |
| Q |
201 |
gttccattccttcttttttacgacaagcccta |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26728855 |
gttccattccttcttttttacgacaagcccta |
26728886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 28876 - 28721
Alignment:
| Q |
1 |
ccaaacacaaaacgacttatctgagctttccctttcaaatgtaagtaatttggcgcaaatacctcaatggttttggggaaaattgcaaacactagaacta |
100 |
Q |
| |
|
|||||||||||| || ||||| ||||||||||||||||| |||||| | | | ||||||| |||||||||||||||||||||||| | ||||| |
|
|
| T |
28876 |
ccaaacacaaaatgaattatccactctttccctttcaaatgtcagtaatatatctccaatacctatttggttttggggaaaattgcaaaca--ataacta |
28779 |
T |
 |
| Q |
101 |
--ttgaacatttcaaacaacaatctcagtggtaggattccagatatggaactcaatct |
156 |
Q |
| |
|
||| ||||||||||||||||||| | ||| | |||||| || | ||||||||||| |
|
|
| T |
28778 |
gcttggacatttcaaacaacaatcttactggcatgattcctaatttagaactcaatct |
28721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 169916 - 170071
Alignment:
| Q |
1 |
ccaaacacaaaacgacttatctgagctttccctttcaaatgtaagtaatttggcgcaaatacctcaatggttttggggaaaattgcaaacactagaacta |
100 |
Q |
| |
|
|||||||||||| || ||||| ||||||||||||||||| |||||| | | | ||||||| |||||||||||||||||||||||| | ||||| |
|
|
| T |
169916 |
ccaaacacaaaatgaattatccactctttccctttcaaatgtcagtaatatatctccaatacctatttggttttggggaaaattgcaaaca--ataacta |
170013 |
T |
 |
| Q |
101 |
--ttgaacatttcaaacaacaatctcagtggtaggattccagatatggaactcaatct |
156 |
Q |
| |
|
||| ||||||||||||||||||| | ||| | |||||| || | ||||||||||| |
|
|
| T |
170014 |
gcttggacatttcaaacaacaatcttactggcatgattcctaatttagaactcaatct |
170071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 94
Target Start/End: Original strand, 181063 - 181099
Alignment:
| Q |
58 |
aatacctcaatggttttggggaaaattgcaaacacta |
94 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
181063 |
aatacctcactggttttgggaaaaattgcaaacacta |
181099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 177 - 220
Target Start/End: Complemental strand, 29507086 - 29507043
Alignment:
| Q |
177 |
atttgagttcaaatcaactcgaaggttccattccttctttttta |
220 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
29507086 |
atttgagttcaaatcaacttgaaggttccattccttccttttta |
29507043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 44613285 - 44613328
Alignment:
| Q |
177 |
atttgagttcaaatcaactcgaaggttccattccttctttttta |
220 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
44613285 |
atttgagttcaaatcagtttgaaggttccattccttctttttta |
44613328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 220
Target Start/End: Complemental strand, 11543990 - 11543952
Alignment:
| Q |
182 |
agttcaaatcaactcgaaggttccattccttctttttta |
220 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
11543990 |
agttcaaatcaacttgaaggttccattccttctctttta |
11543952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 220
Target Start/End: Complemental strand, 44795000 - 44794954
Alignment:
| Q |
174 |
tagatttgagttcaaatcaactcgaaggttccattccttctttttta |
220 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||| |||||| |
|
|
| T |
44795000 |
tagatttgagttcaaatcagtttgaaggttccattccttccttttta |
44794954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 95
Target Start/End: Original strand, 44613135 - 44613203
Alignment:
| Q |
27 |
tttccctttcaaatgtaagtaatttggcgcaaatacctcaatggttttggggaaaattgcaaacactag |
95 |
Q |
| |
|
|||||||||||||||| |||||| | | | || ||||| ||||||||||| |||||||||||||||| |
|
|
| T |
44613135 |
tttccctttcaaatgtgagtaatatatctccaacacctctttggttttggggtaaattgcaaacactag |
44613203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University